si:ch211-105n9.1

Ensembl ID:
ENSDARG00000008249
ZFIN ID:
ZDB-GENE-041001-178
Description:
Patched domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5RIV7]
Human Orthologue:
C6orf138
Human Description:
chromosome 6 open reading frame 138 [Source:HGNC Symbol;Acc:21345]
Mouse Orthologue:
3110082D06Rik
Mouse Description:
RIKEN cDNA 3110082D06 gene Gene [Source:MGI Symbol;Acc:MGI:1920485]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15542 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022572 Nonsense 522 916 3 3
ENSDART00000146055 Nonsense 503 897 3 3
Genomic Location (Zv9):
Chromosome 20 (position 36093915)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36166428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCAGCACTTCCTAAGGGAGCATTACACAGAATGGATAACCAACACCWA[C/A]GTCAAGCCTTTYGTGGTGATSCTCTACCTGATTTATGCCTCRTTTTCRTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link