cct8

Ensembl ID:
ENSDARG00000008243
ZFIN ID:
ZDB-GENE-040426-876
Description:
T-complex protein 1 subunit theta [Source:RefSeq peptide;Acc:NP_957356]
Human Orthologue:
CCT8
Human Description:
chaperonin containing TCP1, subunit 8 (theta) [Source:HGNC Symbol;Acc:1623]
Mouse Orthologue:
Cct8
Mouse Description:
chaperonin containing Tcp1, subunit 8 (theta) Gene [Source:MGI Symbol;Acc:MGI:107183]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41662 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34906 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009477 Essential Splice Site 127 546 4 15

The following transcripts of ENSDARG00000008243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 25973619)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25377476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGAGCTTGCAGAGGAGCTACTGAGAATGGGTCTTTCAGTTTCAGAG[G/T]TCAGCCAACAACAGAACTAATGCACTGTGTCTCTATTTATGTTTAATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009477 Essential Splice Site 314 546 None 15

The following transcripts of ENSDARG00000008243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 25970476)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25374333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATATGGCTCTTCATTATGCCAACAAGTACAAGCTCATGGTGGTCAGG[T/C]AAGAAAAAGACTGATCCGGATCACTTCATCATCCAGGTTGTTTCAAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link