mocs3

Ensembl ID:
ENSDARG00000008239
ZFIN ID:
ZDB-GENE-040426-782
Description:
Adenylyltransferase and sulfurtransferase MOCS3Adenylyltransferase MOCS3Sulfurtransferase MOCS3 [Sou
Human Orthologue:
MOCS3
Human Description:
molybdenum cofactor synthesis 3 [Source:HGNC Symbol;Acc:15765]
Mouse Orthologue:
Mocs3
Mouse Description:
molybdenum cofactor synthesis 3 Gene [Source:MGI Symbol;Acc:MGI:1916622]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14956 Nonsense Available for shipment Available now
sa23157 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa16784 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009528 Nonsense 114 459 4 13
ENSDART00000134111 Nonsense 114 459 4 13

The following transcripts of ENSDARG00000008239 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 42657641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATTTGTCGTTGTTAATGTGTATTTAGGACGCTTGGGTTTGTTGGACTA[T/G]GATGTGGTGGAACTGAGWAACCTGCACAGACAGGTGCTTCACACAGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009528 Essential Splice Site 172 459 None 13
ENSDART00000134111 Missense 173 459 5 13

The following transcripts of ENSDARG00000008239 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 42655197)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTATCACCTCCAGCTGTCCAGAGAGAATGCCATACAACTCATCCAACAG[T/C]ATCCACTCTGGTTAATTGCTGATGAGTGTTAATTTACTTTCTACAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009528 Nonsense 179 459 6 13
ENSDART00000134111 Nonsense 179 459 6 13

The following transcripts of ENSDARG00000008239 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 42655076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTGTCTCCTTGACTGTTSGTCTTATGTATGACATTGTGGCAGACTG[T/A]TCAGACAATGTTCCCACACGGTACCTCGTGAATGATGCCTGTGTTCTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t8pkqhyx