sars

Ensembl ID:
ENSDARG00000008237
ZFIN ID:
ZDB-GENE-040831-1
Description:
seryl-tRNA synthetase, cytoplasmic [Source:RefSeq peptide;Acc:NP_001003882]
Human Orthologue:
SARS
Human Description:
seryl-tRNA synthetase [Source:HGNC Symbol;Acc:10537]
Mouse Orthologue:
Sars
Mouse Description:
seryl-aminoacyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:102809]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa382 Essential Splice Site Available for shipment Available now
sa3234 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003296 Essential Splice Site 69 515 2 11

The following transcripts of ENSDARG00000008237 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 34344036)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34105983
KASP Assay ID:
554-0362.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACAAGGCCAAGAATCTCTGCAGCAAATCCATCGGTGAAAAGATGAAGG[C/T]ATGTAAAGCAGCTGTAATATTTTTTTGATATTTTGTCATTAAGTTTTAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3234
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003296 Essential Splice Site 149 515 4 11

The following transcripts of ENSDARG00000008237 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 34346893)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34108840
KASP Assay ID:
554-3215.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGATCGGCAACCTCCTACATCCCTCTGTGCCCATCAGCAAYGATGAG[G/A]TGAGTTTCAGCCACASTCGCAATTTTCACAAAYACAGCGGAGTCCTGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link