si:dkey-217k21.3

Ensembl ID:
ENSDARG00000008235
ZFIN ID:
ZDB-GENE-041210-47
Description:
conserved oligomeric Golgi complex subunit 5 [Source:RefSeq peptide;Acc:NP_001038609]
Human Orthologue:
COG5
Human Description:
component of oligomeric golgi complex 5 [Source:HGNC Symbol;Acc:14857]
Mouse Orthologue:
Cog5
Mouse Description:
component of oligomeric golgi complex 5 Gene [Source:MGI Symbol;Acc:MGI:2145130]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8385 Nonsense Mutation detected in F1 DNA During 2017
sa20180 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021953 Nonsense 223 810 8 22
Genomic Location (Zv9):
Chromosome 4 (position 2459290)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2658169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGAATCCATCTCAGGTGGGGACAGCCCTACAAGTGTTTTACAACCTT[G/T]GAAATCTGAGAGAGACCATAAGAAGTGTGRTCGACGGATACAGGACATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20180
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021953 Essential Splice Site 774 810 21 22
Genomic Location (Zv9):
Chromosome 4 (position 2421454)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2620333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGGTTGGATGACCATTCATCAGAGAAGGACCGTCTCACTCTTATTAG[G/A]TAAGTTCTGAGACTCAGAACTACAGTTTTATTTTGGCTGATTTCACAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Osteoarthritis: A genome-wide association study identifies an osteoarthritis susceptibility locus on chromosome 7q22. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link