myt1la

Ensembl ID:
ENSDARG00000008209
ZFIN ID:
ZDB-GENE-041001-172
Description:
myelin transcription factor 1-like protein [Source:RefSeq peptide;Acc:NP_001038364]
Human Orthologue:
MYT1L
Human Description:
myelin transcription factor 1-like [Source:HGNC Symbol;Acc:7623]
Mouse Orthologue:
Myt1l
Mouse Description:
myelin transcription factor 1-like Gene [Source:MGI Symbol;Acc:MGI:1100511]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11068 Essential Splice Site Available for shipment Available now
sa10388 Essential Splice Site Available for shipment Available now
sa23731 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044397 Essential Splice Site 1 1257 None 22
ENSDART00000129169 None 1 1257 None 21
ENSDART00000131032 Essential Splice Site 1 539 None 7
Genomic Location:
Chromosome 20 (position 30516588)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGCTCAGCTAGTAGACTGAGGTCAGGCTAATTGCTGCTTCTTTTCTCC[A/T]GATGGAGGTGGATGCGGCAGAGAAGCGTCATCGAACACGATCTAAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044397 Essential Splice Site 26 1257 3 22
ENSDART00000129169 Essential Splice Site 26 1257 2 21
ENSDART00000131032 Essential Splice Site 26 539 4 7
Genomic Location:
Chromosome 20 (position 30516950)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTCATTGTTTTGCAGTTGCCGTAGAGGCTGCACAGGAGCTATTCAGG[T/G]CAGTCTGCCTTTAATATTAGAATCATATTTTTACTKCAAAATACAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044397 Nonsense 741 1257 11 22
ENSDART00000129169 Nonsense 741 1257 10 21
ENSDART00000131032 None None 539 None 7
Genomic Location:
Chromosome 20 (position 30579008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCGCTACTGTAAGACCTCGAGTCCGGCCAGCAGCACCACGAGCAGCTA[C/A]GCTCCCAGCAGCAGCAGCAGCCTGAGCTGTGGAGGAGGAGGAGGGGGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hwqaovii