pank1a

Ensembl ID:
ENSDARG00000008192
ZFIN ID:
ZDB-GENE-040426-2846
Description:
pantothenate kinase 3 [Source:RefSeq peptide;Acc:NP_998645]
Human Orthologue:
PANK1
Human Description:
pantothenate kinase 1 [Source:HGNC Symbol;Acc:8598]
Mouse Orthologue:
Pank1
Mouse Description:
pantothenate kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1922985]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23076 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104724 Essential Splice Site 128 373 None 8
ENSDART00000127583 Essential Splice Site 194 439 None 7
ENSDART00000135814 Essential Splice Site 194 266 None 3
ENSDART00000146787 Essential Splice Site 128 373 None 7

The following transcripts of ENSDARG00000008192 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 23395504)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23545653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCATAAAGACAGCAATGAGCAGTCATGAATCTTTCTCTCTTTTTTTGT[A/G]GATGGCAGATTTGGAACTCCTGAAGTTGGATGAGCTGGACTGTCTGATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolic traits: Genome-wide association analysis of metabolic traits in a birth cohort from a founder population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link