si:ch211-39l18.5

Ensembl ID:
ENSDARG00000008191
ZFIN ID:
ZDB-GENE-070912-294
Human Orthologues:
RP11-61P7.3, TMEFF1
Human Descriptions:
C9orf30-TMEFF1 fusion protein [Source:RefSeq peptide;Acc:NP_001185741]
transmembrane protein with EGF-like and two follistatin-like domains 1 [Source:HGNC Symbol;Acc:11866
Mouse Orthologue:
Tmeff1
Mouse Description:
transmembrane protein with EGF-like and two follistatin-like domains 1 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25880 Nonsense Mutation detected in F1 DNA During 2017
sa25881 Nonsense Mutation detected in F1 DNA During 2017
sa19836 Nonsense Available for shipment Available now
sa18563 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056441 Nonsense 115 326 3 9

The following transcripts of ENSDARG00000008191 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 42280841)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42330305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCCTGTGAACAGCAGAGTCCAATCACCATAATCACAGAAGGACATTG[T/A]CCCGGTCAGTCTAAACACTTGCTAATAAAACCTGTTTCTTATATCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056441 Nonsense 187 326 6 9

The following transcripts of ENSDARG00000008191 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 42285020)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42334484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCAGTGTGTGGATCAGATGGACAGTCTTACAGTAATCCATGTCAGGTC[A/T]GAGAAGCTTCCTGCCTGAAACAAGCTCAGATTAATGTCCGACACCTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056441 Nonsense 205 326 6 9

The following transcripts of ENSDARG00000008191 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 42285076)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42334540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCCTGCCTGAAACAAGCTCAGATTAATGTCCGACACCTTGGACAGTG[T/A]TCAGGTAAACACAAATCCCGCATTAGACGAATCTTTACAATGCTAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056441 Nonsense 256 326 8 9

The following transcripts of ENSDARG00000008191 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 42285897)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42335361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTGGKCTTGTCATTTAGGTGTAATTTGGGGTTTTCTGGCAAGYACTG[T/A]GAGCTAAGAGACTTCAGTGAGTTATATGTGGTGCCCAATGGACAGAAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link