sf1

Ensembl ID:
ENSDARG00000008188
ZFIN ID:
ZDB-GENE-030131-2492
Description:
splicing factor 1 [Source:RefSeq peptide;Acc:NP_997818]
Mouse Orthologue:
Sf1
Mouse Description:
splicing factor 1 Gene [Source:MGI Symbol;Acc:MGI:1095403]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20917 Nonsense Available for shipment Available now
sa40876 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020212 Nonsense 122 165 2 11
ENSDART00000126037 Nonsense 50 565 2 12
ENSDART00000143455 Nonsense 122 248 2 6

The following transcripts of ENSDARG00000008188 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 23978380)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22540132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCGGGCATGCCCACCGTGATCCCTCCTGGGCTGACTCGGGACCAAGAA[C/T]GAGCTTATATAGGTGAATATCTAAAATTTGCTATTACAACATCTGTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020212   None 165 4 11
ENSDART00000126037 Nonsense 147 565 5 12
ENSDART00000143455 Nonsense 219 248 5 6

The following transcripts of ENSDARG00000008188 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 23983396)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22545148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCGGCAACACGGGTCAGTGATAAGGTGATGATTCCTCAGGATGAATA[T/A]CCAGAGATCAACTTTGTTGGGCTTTTAATTGGGCCACGGTGAGTAGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link