mia3

Ensembl ID:
ENSDARG00000008184
ZFIN ID:
ZDB-GENE-041014-270
Description:
Novel protein similar to vertebrate meningioma expressed antigen 6 (Coiled-coil proline-rich) (MGEA6
Human Orthologue:
MIA3
Human Description:
melanoma inhibitory activity family, member 3 [Source:HGNC Symbol;Acc:24008]
Mouse Orthologue:
Mia3
Mouse Description:
melanoma inhibitory activity 3 Gene [Source:MGI Symbol;Acc:MGI:2443183]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3093 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041476 Essential Splice Site 404 786 13 23
ENSDART00000060505 Essential Splice Site 1492 1874 19 29
ENSDART00000138457 None None 474 None 7
Genomic Location:
Chromosome 20 (position 52136935)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGATCACCACTGARCTCTACCAGCAGAAGGAGAACGCACTGCAACAG[T/C]GAGATCACGTGTTAATCWCATCTTATTTGAACAAGATCAGACTCTCTAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8tdz0ebk