mia3

Ensembl ID:
ENSDARG00000008184
ZFIN ID:
ZDB-GENE-041014-270
Description:
Novel protein similar to vertebrate meningioma expressed antigen 6 (Coiled-coil proline-rich) (MGEA6
Human Orthologue:
MIA3
Human Description:
melanoma inhibitory activity family, member 3 [Source:HGNC Symbol;Acc:24008]
Mouse Orthologue:
Mia3
Mouse Description:
melanoma inhibitory activity 3 Gene [Source:MGI Symbol;Acc:MGI:2443183]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37175 Nonsense Mutation detected in F1 DNA During 2016
sa32319 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041476 Nonsense 262 786 9 23
ENSDART00000060505 Nonsense 1350 1874 15 29
ENSDART00000138457   None 474 None 7
Genomic Location (Zv9):
Chromosome 20 (position 52141137)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51990375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACAAGAAGCTGAGCGAGGAGATCCGAGTTTATCACAAATCCCAGAAA[G/T]AGCTGGAAGACTCTCTGGTGCACAAGGAGAACGAGATCGATGTGAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041476 Nonsense 567 786 19 23
ENSDART00000060505 Nonsense 1655 1874 25 29
ENSDART00000138457   None 474 None 7
Genomic Location (Zv9):
Chromosome 20 (position 52114252)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51963490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATGTTTGATTGTTTTCTCTTAGTAACCTTTGGTGTATTTCAGGTCCA[C/T]GACCCCCGTCTGATCCTCACGGACGCTTCTCTGAGCTTGGACACCCGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link