hoxb1a

Ensembl ID:
ENSDARG00000008174
ZFIN ID:
ZDB-GENE-990415-101
Description:
Homeobox protein Hox-B1a [Source:UniProtKB/Swiss-Prot;Acc:O42366]
Human Orthologue:
HOXB1
Human Description:
homeobox B1 [Source:HGNC Symbol;Acc:5111]
Mouse Orthologue:
Hoxb1
Mouse Description:
homeobox B1 Gene [Source:MGI Symbol;Acc:MGI:96182]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33162 Nonsense Mutation detected in F1 DNA During 2016
sa31326 Nonsense Available for shipment Available now
sa1191 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110682 Nonsense 5 316 1 2
Genomic Location (Zv9):
Chromosome 3 (position 24060190)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23638401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGATTTCTCAGGTTGTCCCTCCGCCATTAATTGCGTATGGACAGTTCC[A/T]GAATGAACTCTTTCTTGGAGTACACAATTTGTAACCGTGGGACGAACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110682 Nonsense 239 316 2 2
Genomic Location (Zv9):
Chromosome 3 (position 24061630)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23639841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACACTATTCGGACAAATTTCACAACCAAACAACTGACAGAGCTCGAA[A/T]AAGAATTTCACTTCAGCAAGTATCTGACGCGAGCGCGGCGTGTGGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110682 Nonsense 269 316 2 2
Genomic Location (Zv9):
Chromosome 3 (position 24061722)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23639933
KASP Assay ID:
554-1100.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAGATTGCTGCCACACTTGAGCTYAACGAGACGCAGGTTAAGATTTG[G/A]TTTCAAAACCGCCGAATGAAACAGAAGAAGCGAGAGAAGGAGGGACTCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link