hoxb1a

Ensembl ID:
ENSDARG00000008174
ZFIN ID:
ZDB-GENE-990415-101
Description:
Homeobox protein Hox-B1a [Source:UniProtKB/Swiss-Prot;Acc:O42366]
Human Orthologue:
HOXB1
Human Description:
homeobox B1 [Source:HGNC Symbol;Acc:5111]
Mouse Orthologue:
Hoxb1
Mouse Description:
homeobox B1 Gene [Source:MGI Symbol;Acc:MGI:96182]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1191 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110682 Nonsense 269 316 2 2
Genomic Location:
Chromosome 3 (position 24061722)
KASP Assay ID:
554-1100.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAGATTGCTGCCACACTTGAGCTYAACGAGACGCAGGTTAAGATTTG[G/A]TTTCAAAACCGCCGAATGAAACAGAAGAAGCGAGAGAAGGAGGGACTCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6mws5vkw