caspa

Ensembl ID:
ENSDARG00000008165
ZFIN ID:
ZDB-GENE-000616-3
Description:
caspase a [Source:RefSeq peptide;Acc:NP_571580]
Human Orthologues:
CASP1, CASP12, CASP4, CASP5
Human Descriptions:
caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) [Source:HGNC Symbo
caspase 12 (gene/pseudogene) [Source:HGNC Symbol;Acc:19004]
caspase 4, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1505]
caspase 5, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1506]
Mouse Orthologues:
Casp1, Casp12, Casp4
Mouse Descriptions:
caspase 1 Gene [Source:MGI Symbol;Acc:MGI:96544]
caspase 12 Gene [Source:MGI Symbol;Acc:MGI:1312922]
caspase 4, apoptosis-related cysteine peptidase Gene [Source:MGI Symbol;Acc:MGI:107700]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36229 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034544 Nonsense 158 383 3 7
Genomic Location (Zv9):
Chromosome 16 (position 44770518)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42051026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCAGAAAACGACTGGCCTTGCTTATCAACAACGTGGATTTTGACGAT[A/T]AGGCTATGAAAAGGAGCGGCTCAGAGAAAGATGAAGAGAACATGGAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link