LOC799840

Ensembl ID:
ENSDARG00000008164
Human Orthologues:
CTD-2611O12.2, CTD-2611O12.3, ERMAP, RFPL1, RFPL2, RFPL3, RFPL4A, RFPL4B
Human Descriptions:
erythroblast membrane-associated protein (Scianna blood group) [Source:HGNC Symbol;Acc:15743]
ret finger protein-like 1 [Source:HGNC Symbol;Acc:9977]
ret finger protein-like 2 [Source:HGNC Symbol;Acc:9979]
ret finger protein-like 3 [Source:HGNC Symbol;Acc:9980]
ret finger protein-like 4A [Source:HGNC Symbol;Acc:16449]
ret finger protein-like 4B [Source:HGNC Symbol;Acc:33264]
Mouse Orthologues:
Ermap, Rfpl4
Mouse Descriptions:
erythroblast membrane-associated protein Gene [Source:MGI Symbol;Acc:MGI:1349816]
ret finger protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2149590]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4279 Nonsense Mutation detected in F1 DNA During 2014
sa12068 Nonsense Available for shipment Available now
sa5988 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066816 Nonsense 308 532 5 7
Genomic Location:
Chromosome 24 (position 7822654)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGGCTTTCCCTACCCTAAGTGAGRTGCCACACTGTAAAAGCTGGTCT[C/T]AGATCAGTGCTCACACCTGTGAGGGTCTGGAATTGCTGAGAGAAACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066816 Nonsense 315 532 5 7
Genomic Location:
Chromosome 24 (position 7822675)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGRTGCCACACTGTAAAAGCTGGTCTYAGATCAGTGCTCACACCTGT[G/T]AGGGTCTGGAATTGYTGAGAGAAACCCTGAATGCAGCAGAAGAACTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066816 Essential Splice Site 351 532 6 7
Genomic Location:
Chromosome 24 (position 7822868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTTTTTTATTTTCCCACAGAACTTGAGGCCWTATCTCAGTATGCAGG[T/C]AATATAATATTTTTAAAAGACAKAATCTTTCATAAACTTACTATAACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bpv9q16l