foxl1

Ensembl ID:
ENSDARG00000008133
ZFIN ID:
ZDB-GENE-040426-1181
Description:
forkhead box protein L1 [Source:RefSeq peptide;Acc:NP_957278]
Human Orthologue:
FOXL1
Human Description:
forkhead box L1 [Source:HGNC Symbol;Acc:3817]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1842 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018764 Nonsense 79 360 1 1
Genomic Location:
Chromosome 18 (position 17144262)
KASP Assay ID:
554-1833.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCAATCAAGAACGCGCCGGACAAGCGCGCGACCCTCAGCGGGATCTA[T/A]CAGTTCATCATGGACCGCTTCCCATATTATCACGACAACAAACAAGGTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cy9lg8v6