pcdh15b

Ensembl ID:
ENSDARG00000008127
ZFIN ID:
ZDB-GENE-050214-1
Description:
protocadherin 15b [Source:RefSeq peptide;Acc:NP_001012504]
Human Orthologue:
PCDH15
Human Description:
protocadherin-related 15 [Source:HGNC Symbol;Acc:14674]
Mouse Orthologue:
Pcdh15
Mouse Description:
protocadherin 15 Gene [Source:MGI Symbol;Acc:MGI:1891428]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35208 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30955 Nonsense Mutation detected in F1 DNA During 2017
sa22027 Nonsense Available for shipment Available now
sa22026 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Essential Splice Site 276 1848 6 29
ENSDART00000106391 Essential Splice Site 276 1848 6 31
ENSDART00000133868   None 1160 None 16
Genomic Location (Zv9):
Chromosome 12 (position 7451481)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6734212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCAGCCTCCGTCAGACCGCCCAGGAATCCTGTACTCTATCCTCATAG[G/A]TAAGTCGCCATCAGACTCTAGCCATTCTCTCTATAAAGCAGCATCTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Nonsense 911 1848 19 29
ENSDART00000106391 Nonsense 911 1848 19 31
ENSDART00000133868 Nonsense 223 1160 4 16
Genomic Location (Zv9):
Chromosome 12 (position 7326005)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6608736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTTTTAACATTTTCATTATTGTTGTCTTTTAGGGTACAGCGGCAAGT[C/T]GAGTTCACTATAAAGCGGATCTGGAGCAGTTTCCTTACAGCACTAGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Nonsense 1655 1848 29 29
ENSDART00000106391 Nonsense 1655 1848 31 31
ENSDART00000133868 Nonsense 967 1160 16 16
Genomic Location (Zv9):
Chromosome 12 (position 7250673)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6533404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGGTCAATGTGGAGATCATTCCAGACCCTCCTGATGTACCTGCTCCA[C/T]AACCACCACCACCGCCTCCACCTCCCTCCAGTCCGCCCCCACCCCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22026
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Nonsense 1807 1848 29 29
ENSDART00000106391 Nonsense 1807 1848 31 31
ENSDART00000133868 Nonsense 1119 1160 16 16
Genomic Location (Zv9):
Chromosome 12 (position 7250217)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6532948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAAAGCAGCGCCCACTAGTGATCAACCCTAAACCGCAAGTGTCTGTC[G/T]AACCAGAGGCTGGTGTAACAGAGGCGGAGCCTGCTCAAGAAGGACCACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link