si:ch211-195d17.2

Ensembl ID:
ENSDARG00000008119
ZFIN ID:
ZDB-GENE-030131-513
Description:
transcription factor E2F6 [Source:RefSeq peptide;Acc:NP_001025315]
Human Orthologue:
E2F6
Human Description:
E2F transcription factor 6 [Source:HGNC Symbol;Acc:3120]
Mouse Orthologue:
E2f6
Mouse Description:
E2F transcription factor 6 Gene [Source:MGI Symbol;Acc:MGI:1354159]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14835 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015928 Essential Splice Site 107 406 None 8
ENSDART00000130599 Essential Splice Site 107 313 None 5
ENSDART00000131219 Essential Splice Site 107 405 None 8
Genomic Location (Zv9):
Chromosome 20 (position 29709276)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29780489
KASP Assay ID:
1641-0495.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTCGTTTGAGGAGGAGCAGGACGAGCACACGGGGACACTCGAGGAGG[T/C]TGGTGGAGTGCGGGGATATCCTCAAAACTTACCTACAGAAAGGGGTATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link