eef1da

Ensembl ID:
ENSDARG00000008109
ZFIN ID:
ZDB-GENE-040426-2740
Description:
elongation factor-1, delta, a [Source:RefSeq peptide;Acc:NP_001170924]
Human Orthologue:
EEF1D
Human Description:
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) [Source:HGNC
Mouse Orthologue:
Eef1d
Mouse Description:
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39949 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25926 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33051 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002962 Essential Splice Site 61 267 4 8
ENSDART00000097893 Essential Splice Site None 163 3 7
ENSDART00000131905   None 232 None 4
ENSDART00000141845 Essential Splice Site 61 255 4 7
ENSDART00000144384 Essential Splice Site 39 245 3 7
ENSDART00000145344 Essential Splice Site 63 257 4 7
ENSDART00000145773 Essential Splice Site 68 254 5 8

The following transcripts of ENSDARG00000008109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 52392431)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51291430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTATTAGATTTAATTCACTAATATTGAATTTTTTCATCTGATTTGCA[G/A]AGTCAGAATGCCAGCAAGTCTGAAGATCAGAGCGAACTGGTCTCACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002962 Essential Splice Site 90 267 None 8
ENSDART00000097893 Essential Splice Site None 163 None 7
ENSDART00000131905   None 232 None 4
ENSDART00000141845 Essential Splice Site 90 255 None 7
ENSDART00000144384 Essential Splice Site 68 245 None 7
ENSDART00000145344 Essential Splice Site 92 257 None 7
ENSDART00000145773 Essential Splice Site 97 254 None 8

The following transcripts of ENSDARG00000008109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 52389858)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51294003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCTGCTTGTGATGTATGAAATTAACAAATCTATTGTTGTTGTTTTC[A/G]GTGGTGGATGATCTGAGAGCCACACTGTCCAAACTGGAGTCCAGAATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002962 Essential Splice Site 123 267 5 8
ENSDART00000097893 Essential Splice Site 19 163 4 7
ENSDART00000131905   None 232 None 4
ENSDART00000141845 Essential Splice Site 123 255 5 7
ENSDART00000144384 Essential Splice Site 101 245 4 7
ENSDART00000145344 Essential Splice Site 125 257 5 7
ENSDART00000145773 Essential Splice Site 130 254 6 8

The following transcripts of ENSDARG00000008109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 52389755)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51294106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGGAGAAAACTCAAGCACCAGCTACAAAAGGAGTTACTGTCACCAAG[G/A]TAAATGTGAAGTCCTGAAACTCACTTTTGTGCATTAAACCATAATCTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link