mettl2a

Ensembl ID:
ENSDARG00000008105
ZFIN ID:
ZDB-GENE-050417-462
Description:
Methyltransferase-like protein 2-A [Source:UniProtKB/Swiss-Prot;Acc:A8KBL7]
Human Orthologues:
METTL2A, METTL2B
Human Descriptions:
methyltransferase like 2A [Source:HGNC Symbol;Acc:25755]
methyltransferase like 2B [Source:HGNC Symbol;Acc:18272]
Mouse Orthologue:
Mettl2
Mouse Description:
methyltransferase like 2 Gene [Source:MGI Symbol;Acc:MGI:1289171]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13444 Nonsense Available for shipment Available now
sa19983 Nonsense Available for shipment Available now
sa13383 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007857 Nonsense 97 353 3 9

The following transcripts of ENSDARG00000008105 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 19561586)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWTCTAGAGGAGTTTGACRACAGGGCCAATGAATACTGGAATGACTTTTA[C/A]ACCATTCACGAGAACCGCTTCTTYAAGGATCGTCACTGGCTCTTTACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007857 Nonsense 273 353 7 9

The following transcripts of ENSDARG00000008105 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 19565598)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTGCTGAAACCCGGAGGAGTGTTGTTATTGAGAGACTATGGCCGATA[T/A]GACATGGCACAGCTACGTTTCAAAAAAGGTAAATGTTTTGACCTTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007857 Nonsense 326 353 9 9

The following transcripts of ENSDARG00000008105 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 19569678)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTTCTCCAGTGCKGGTCTGGAGAAGCTGCAGAATTTGGTGGATCGA[C/T]GWTTGCAGGTGAACAGAGGAAAGCAGCTTACAATGTACAGAGTCTGGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4ndqn8ix