olfcd1

Ensembl ID:
ENSDARG00000008095
ZFIN ID:
ZDB-GENE-100721-9
Description:
Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3KQM3]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43131 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43132 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23324 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028134 Essential Splice Site 477 774 4 5
ENSDART00000099094 Essential Splice Site 533 832 6 7
Genomic Location (Zv9):
Chromosome 18 (position 31444296)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33241155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTATGACTGTATCCCATGCGCAGAGGGAGAAATCAGTAATTATACAG[G/A]TAAAATAGTAGTTGTGAGATACCTCTCATAAAAGTTTGGTGAAGTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028134 Essential Splice Site 478 774 4 5
ENSDART00000099094 Essential Splice Site 534 832 6 7
Genomic Location (Zv9):
Chromosome 18 (position 31444297)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33241156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTATGACTGTATCCCATGCGCAGAGGGAGAAATCAGTAATTATACAGG[T/C]AAAATAGTAGTTGTGAGATACCTCTCATAAAAGTTTGGTGAAGTGTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028134 Nonsense 690 774 5 5
ENSDART00000099094 Nonsense 746 832 7 7
Genomic Location (Zv9):
Chromosome 18 (position 31445048)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33241907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGCTGTTCTGGGTTATACTGGCCTGTTATCAACCTTGTGTTTTGTTT[T/A]AGCTTTTTTTGCTCGAAAACTCCCAGATAACTTCAATGAAGCCAAGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link