si:dkey-217m5.5

Ensembl ID:
ENSDARG00000008060
ZFIN ID:
ZDB-GENE-041014-317
Description:
Novel protein similar to human and mouse scavenger receptor class A, member 3 (SCARA3) [Source:UniPr
Human Orthologue:
SCARA3
Human Description:
scavenger receptor class A, member 3 [Source:HGNC Symbol;Acc:19000]
Mouse Orthologue:
Scara3
Mouse Description:
scavenger receptor class A, member 3 Gene [Source:MGI Symbol;Acc:MGI:2444418]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12458 Nonsense Available for shipment Available now
sa29429 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002481 Nonsense 137 586 6 7
ENSDART00000146683 Nonsense 129 578 4 5
Genomic Location (Zv9):
Chromosome 20 (position 39322500)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39394912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGAAGGAGTTWGAAGAAATCCAGAAGACGATACTCAGTCAAGAGCAA[C/T]AGATGAATGAGGCGACCCAAWCCCAGCAAAGTCTTACACAATCCAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002481 Nonsense 323 586 6 7
ENSDART00000146683 Nonsense 315 578 4 5
Genomic Location (Zv9):
Chromosome 20 (position 39323060)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39395472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGAGCACGAGGAGAACATGCATGACCACCAGTACCACGCCAAGTATTA[T/A]GAGAACCGTACTGGGGAGCGATTTGTCACTTTGGATGCAAGAATGGACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link