nudc

Ensembl ID:
ENSDARG00000008052
ZFIN ID:
ZDB-GENE-040426-899
Description:
nuclear migration protein nudC [Source:RefSeq peptide;Acc:NP_957213]
Human Orthologue:
NUDC
Human Description:
nuclear distribution gene C homolog (A. nidulans) [Source:HGNC Symbol;Acc:8045]
Mouse Orthologue:
Nudc
Mouse Description:
nuclear distribution gene C homolog (Aspergillus) Gene [Source:MGI Symbol;Acc:MGI:106014]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14960 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14960
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010992 Nonsense 39 149 1 4
Genomic Location (Zv9):
Chromosome 19 (position 30611064)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14302797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGCACACTAAAGGTGGGCTTGAAGGGTCACCCGCCTCTGATCGATGGA[C/T]AACTCTTCAATGAGGTCAAAGTGGAGGAGAGCTCATGGCTCATCGAGGAW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link