sart3

Ensembl ID:
ENSDARG00000008032
ZFIN ID:
ZDB-GENE-040724-10
Description:
squamous cell carcinoma antigen recognized by T-cells 3 [Source:RefSeq peptide;Acc:NP_001025289]
Human Orthologue:
SART3
Human Description:
squamous cell carcinoma antigen recognized by T cells 3 [Source:HGNC Symbol;Acc:16860]
Mouse Orthologue:
Sart3
Mouse Description:
squamous cell carcinoma antigen recognized by T-cells 3 Gene [Source:MGI Symbol;Acc:MGI:1858230]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31425 Essential Splice Site Available for shipment Available now
sa6968 Nonsense Mutation detected in F1 DNA During 2017
sa33571 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008402 Essential Splice Site 66 951 None 19
ENSDART00000122342 Essential Splice Site 66 622 None 16
ENSDART00000124545 Essential Splice Site 66 951 None 20
ENSDART00000125403 Essential Splice Site 66 586 None 16
Genomic Location (Zv9):
Chromosome 5 (position 22237498)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19950370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGGACGAGCGGGAGAATGAAGCCGAGATCCAGCGGCTGGAGGAGCAGG[T/G]GAGGAATGAATGAGGCTAAAGGCGCTCCTACTCACATACGCAGCTCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008402 Nonsense 220 951 5 19
ENSDART00000122342 Nonsense 220 622 5 16
ENSDART00000124545 Nonsense 220 951 6 20
ENSDART00000125403 Nonsense 220 586 5 16
Genomic Location (Zv9):
Chromosome 5 (position 22243353)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19956225
KASP Assay ID:
554-4993.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCAGCCTCCTCCTGGCACTGTTCCATCACAAGAGCAGCAGGAACTGT[T/A]GAGCGCACAGCTCGAGCGCATACACACACTCTTCAGACGGCAGCTAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008402 Nonsense 523 951 13 19
ENSDART00000122342 Nonsense 523 622 13 16
ENSDART00000124545 Nonsense 523 951 14 20
ENSDART00000125403 Nonsense 523 586 13 16
Genomic Location (Zv9):
Chromosome 5 (position 22254759)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19967631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCAGGAAGGCTCTTCACAGAGCAGTACAGTGTACATCAGACTACCCT[G/T]AGCACGTGTGTGATGTCCTGCTCAACTTTGAAAGAGTGGAAGGTCAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link