mep1a.2

Ensembl ID:
ENSDARG00000008029
ZFIN ID:
ZDB-GENE-041001-208
Description:
meprin A subunit alpha [Source:RefSeq peptide;Acc:NP_001122199]
Human Orthologue:
MEP1A
Human Description:
meprin A, alpha (PABA peptide hydrolase) [Source:HGNC Symbol;Acc:7015]
Mouse Orthologue:
Mep1a
Mouse Description:
meprin 1 alpha Gene [Source:MGI Symbol;Acc:MGI:96963]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11789 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026234 Nonsense 197 689 8 14
ENSDART00000141675 Nonsense 172 664 6 12
Genomic Location:
Chromosome 20 (position 35511456)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAAGGAGCACAAYTTYAATAAGTACGMGGATGATTTTATCACTGATT[T/A]GAACACACCCTATGATTATGAGTCCATCATGCACTACAGGCCTCTGTCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tcn2auyu