mxg

Ensembl ID:
ENSDARG00000008019
ZFIN ID:
ZDB-GENE-030721-10
Description:
myxovirus (influenza virus) resistance G [Source:RefSeq peptide;Acc:NP_001116443]
Human Orthologues:
AC019294.4, MX1, MX2
Human Descriptions:
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
Mouse Orthologues:
Mx1, Mx2
Mouse Descriptions:
myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24663 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24664 Nonsense Mutation detected in F1 DNA During 2014
sa7260 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104340 Essential Splice Site 241 628 5 13
Genomic Location:
Chromosome 25 (position 20193854)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTAAAACTTGCACAAGAAGTAGATCCTGAGGGCAAAAGAACTATTGG[T/A]AATGTAATACAGAACACCTGTATATAAACACACACGCAAACATTAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104340 Nonsense 369 628 8 13
Genomic Location:
Chromosome 25 (position 20198079)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATCTAAAAGAGTGTGAGTCTGGACCCCCACAGGATTCAAAAGGGGCC[A/T]AACAATTTCTTATTAAAGTAAGAAGTTTTAATTATCCCATCTAGCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104340 Nonsense 421 628 10 13
Genomic Location:
Chromosome 25 (position 20200680)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGTATTSTCTTTTAATAAGAAATGCATATTGTTCTCCAACAAGTAAAA[C/T]AATCAACTAAAGAGAAAATAGAGGTTCTCCAGAATTTCAGAGGGAGAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/siesly5c