pou2f1b

Ensembl ID:
ENSDARG00000007996
ZFIN ID:
ZDB-GENE-030131-2422
Description:
POU domain, class 2, transcription factor 1 [Source:RefSeq peptide;Acc:NP_001082798]
Human Orthologue:
POU2F1
Human Description:
POU class 2 homeobox 1 [Source:HGNC Symbol;Acc:9212]
Mouse Orthologue:
Pou2f1
Mouse Description:
POU domain, class 2, transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101898]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41470 Nonsense Mutation detected in F1 DNA During 2017
sa34687 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035522 Nonsense 366 676 9 13
ENSDART00000144272 Nonsense 316 626 7 11
ENSDART00000146480 Nonsense 366 676 9 13
ENSDART00000147913   None 284 None 8
Genomic Location (Zv9):
Chromosome 9 (position 35315243)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34534754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATGATTGCAGACCAGCTCAATATGGAGAAGGAGGTGATCCGAGTGTG[G/A]TTCTGTAACCGCAGACAGAAGGAGAAGAGGATCAACCCGCCCAACAACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035522 Nonsense 546 676 11 13
ENSDART00000144272 Nonsense 496 626 9 11
ENSDART00000146480 Nonsense 546 676 11 13
ENSDART00000147913   None 284 None 8
Genomic Location (Zv9):
Chromosome 9 (position 35317826)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34537337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCCATGGCTGCCGCCGCGGGCCTTAATCCTGGGCTCATGGCGTCCTCA[C/T]AGTTCGCCCCTGGGTGAGTGCTCTTTTAGACCTTCTGACCTCAGGTTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link