nedd8

Ensembl ID:
ENSDARG00000007989
ZFIN IDs:
ZDB-GENE-030616-588, ZDB-GENE-040718-295
Description:
neural precursor cell expressed, developmentally down-regulated 8 [Source:RefSeq peptide;Acc:NP_958
Human Orthologue:
NEDD8
Human Description:
neural precursor cell expressed, developmentally down-regulated 8 [Source:HGNC Symbol;Acc:7732]
Mouse Orthologue:
Nedd8
Mouse Description:
neural precursor cell expressed, developmentally down-regulated gene 8 Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40881 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018580 Essential Splice Site 50 89 3 4
Genomic Location (Zv9):
Chromosome 7 (position 25374441)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23936193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGAATCCCACCTCAGCAACAGAGACTCATCTACAGTGGGAAACAGAT[G/A]TAGGTCATTGTACACGTTGTGTTCCTGTACATCTTTGTAGATACATTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link