masp2

Ensembl ID:
ENSDARG00000007988
ZFIN ID:
ZDB-GENE-060130-154
Description:
mannan-binding lectin serine protease 2 [Source:RefSeq peptide;Acc:NP_001116330]
Human Orthologue:
MASP2
Human Description:
mannan-binding lectin serine peptidase 2 [Source:HGNC Symbol;Acc:6902]
Mouse Orthologue:
Masp2
Mouse Description:
mannan-binding lectin serine peptidase 2 Gene [Source:MGI Symbol;Acc:MGI:1330832]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12267 Nonsense Available for shipment Available now
sa14721 Essential Splice Site Available for shipment Available now
sa6742 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035290 Nonsense 122 684 3 11
ENSDART00000132179 Nonsense 123 685 3 11
ENSDART00000142273 Nonsense 131 376 3 9

The following transcripts of ENSDARG00000007988 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 29015657)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCAGCAGCATGTCGGTAGTCTTCAGATCAGATTACTCCAATGAGGAC[C/T]GATTCACAGGCTTCCASGCRTTTTTCTCCGCTGAAGGYGATGGAAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035290 Essential Splice Site 134 684 None 11
ENSDART00000132179 Essential Splice Site 135 685 None 11
ENSDART00000142273 Essential Splice Site 143 376 None 9

The following transcripts of ENSDARG00000007988 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 29015695)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAATGAGGACYGATTCACAGGCTTCCASGCRTTTTTCTCCGCTGAAGG[T/C]GATGGAAACAATGGATTCATAGCATGACTGACCCWGTCTTTCTGTCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035290 Nonsense 479 684 11 11
ENSDART00000132179 Nonsense 480 685 11 11
ENSDART00000142273 None None 376 None 9

The following transcripts of ENSDARG00000007988 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 29038232)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCTCTCTGCTGTCGGACGGCTGGRTTCTCACCGCTGCTCATGTCGTG[A/T]AATCCTTYGAGGACTCTGCCAATCTGCAGCTGAGGATGGGCACAGTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ofqdx5eg