si:ch211-220f16.2

Ensembl ID:
ENSDARG00000007976
ZFIN ID:
ZDB-GENE-070912-199
Human Orthologues:
AC104809.3, CEP110, CEP250, CROCC, GOLGA4
Human Descriptions:
centrosomal protein 110kDa [Source:HGNC Symbol;Acc:1858]
centrosomal protein 250kDa [Source:HGNC Symbol;Acc:1859]
ciliary rootlet coiled-coil, rootletin [Source:HGNC Symbol;Acc:21299]
golgin A4 [Source:HGNC Symbol;Acc:4427]
Mouse Orthologues:
Cep110, Cep250, Crocc, Golga4
Mouse Descriptions:
centrosomal protein 110 Gene [Source:MGI Symbol;Acc:MGI:1889576]
centrosomal protein 250 Gene [Source:MGI Symbol;Acc:MGI:108084]
ciliary rootlet coiled-coil, rootletin Gene [Source:MGI Symbol;Acc:MGI:3529431]
golgi autoantigen, golgin subfamily a, 4 Gene [Source:MGI Symbol;Acc:MGI:1859646]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1393 Nonsense F2 line generated During 2017
sa2986 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1393
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016986   None 1223 None 18
ENSDART00000136073 Nonsense 66 266 3 7
Genomic Location (Zv9):
Chromosome 18 (position 29967718)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30039975
KASP Assay ID:
554-1305.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTGATCAGGGAGAAAGATGCAGTACTCAGCAGTAAAGATGAGCAAGTC[A/T]AGGTAATTTCTGTTTCTGAAAGAATATTTTCTGTGTCAGTGCAATGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2986
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016986 Nonsense 5 1223 1 18
ENSDART00000136073 Nonsense 71 266 4 7
Genomic Location (Zv9):
Chromosome 18 (position 29964100)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30036357
KASP Assay ID:
554-3366.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTGCCATAATTTATGTGTGTGTGTNNNNTTGTTTGGTAGGAGCTGACAGAA[C/T]AAATGCAGCGCTTGCGGAGTGAGAGAGAACACTCTGAATCAAAGCTGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link