hibadhb

Ensembl ID:
ENSDARG00000007959
ZFIN ID:
ZDB-GENE-040426-1582
Description:
3-hydroxyisobutyrate dehydrogenase b [Source:RefSeq peptide;Acc:NP_957454]
Human Orthologue:
HIBADH
Human Description:
3-hydroxyisobutyrate dehydrogenase [Source:HGNC Symbol;Acc:4907]
Mouse Orthologue:
Hibadh
Mouse Description:
3-hydroxyisobutyrate dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:1889802]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5622 Nonsense F2 line generated During 2017
sa2861 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa5622
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006429 Nonsense 72 329 2 8
ENSDART00000006429 Nonsense 72 329 2 8

The following transcripts of ENSDARG00000007959 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22958695)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21068446
KASP Assay ID:
554-3070.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATCCAGTGATCGCCACAGATGTATTTCCAGAATCTTGCAAAGAGCTG[C/T]AGGAACTCGGAGCTCAGGTCAGGATAACAGACATAAAACTTTATAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2861
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006429 Nonsense 72 329 2 8
ENSDART00000006429 Nonsense 72 329 2 8

The following transcripts of ENSDARG00000007959 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22958695)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21068446
KASP Assay ID:
554-3070.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATCCAGTGATCGCCACAGATGTATTTCCAGAATCTTGCAAAGAGCTG[C/T]AGGAACTCGGAGCTCAGGTCAGGATAACAGACATAAAACTTTATAACATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link