iars

Ensembl ID:
ENSDARG00000007955
ZFIN ID:
ZDB-GENE-030131-6325
Description:
isoleucyl-tRNA synthetase, cytoplasmic [Source:RefSeq peptide;Acc:NP_956190]
Human Orthologue:
IARS
Human Description:
isoleucyl-tRNA synthetase [Source:HGNC Symbol;Acc:5330]
Mouse Orthologue:
Iars
Mouse Description:
isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21826 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004423 Nonsense 409 1270 13 35
Genomic Location:
Chromosome 11 (position 1335417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATATTGAACAACTCGTTGGTTTGCAGGTCGGACACGCCGCTGATCTA[C/A]AAAGCAGTGCCCAGCTGGTTTATAAGGGTGGAGCACATGGTGGAGAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7ecfgs0w