itga11b

Ensembl ID:
ENSDARG00000007950
ZFIN ID:
ZDB-GENE-071009-4
Human Orthologue:
ITGA11
Human Description:
integrin, alpha 11 [Source:HGNC Symbol;Acc:6136]
Mouse Orthologue:
Itga11
Mouse Description:
integrin alpha 11 Gene [Source:MGI Symbol;Acc:MGI:2442114]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8853 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44212 Essential Splice Site Mutation detected in F1 DNA During 2017
sa5994 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022861 Essential Splice Site 570 1164 13 29
Genomic Location (Zv9):
Chromosome 25 (position 1339918)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1292388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTACCTCTTCTACGGGCTGAAAAACAGCATACAAACCAAATATAAACAG[G/A]TACGAGTTAACTRAGAGTGACTGATAKTTRATAAACATGAATGAACCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022861 Essential Splice Site 1070 1164 26 29
ENSDART00000022861 Essential Splice Site 1070 1164 26 29
Genomic Location (Zv9):
Chromosome 25 (position 1362980)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1269326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTTAGCATCACCGTCACAGGATGGCTCAATCTTCACACTTTATTAGCC[G/T]TGAGTATGTTAGAAATAAGTAACGAATAACTGACAAAAATGAGTTTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022861 Essential Splice Site 1070 1164 26 29
ENSDART00000022861 Essential Splice Site 1070 1164 26 29
Genomic Location (Zv9):
Chromosome 25 (position 1362980)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1269326
KASP Assay ID:
554-3949.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTTAGCATCACCGTCACAGGATGGCTCAATCTTCACACTTTATTAGCC[G/A]TGAGTATGTTAGAAATAAGTAACGAATAACTGACAAAAATGAGTTTGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link