lhx1b

Ensembl ID:
ENSDARG00000007944
ZFIN ID:
ZDB-GENE-980526-116
Description:
LIM homeobox 1b [Source:RefSeq peptide;Acc:NP_571282]
Human Orthologue:
LHX1
Human Description:
LIM homeobox 1 [Source:HGNC Symbol;Acc:6593]
Mouse Orthologue:
Lhx1
Mouse Description:
LIM homeobox protein 1 Gene [Source:MGI Symbol;Acc:MGI:99783]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa129 Nonsense F2 line generated During 2016
sa33723 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17709 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa129
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021159 Nonsense 110 402 2 5
Genomic Location:
Chromosome 5 (position 57680078)
KASP Assay ID:
554-0973.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAATAAACAGCTTTCCACCGGCGAAGAACTGTACATCCTAGATGAATA[T/A]AAATTTGTCTGCAAGGAGGATTACTTGAATAACAGCAATGGAAAAGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021159 Essential Splice Site 131 402 2 5
Genomic Location:
Chromosome 5 (position 57680143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGATTACTTGAATAACAGCAATGGAAAAGACACAAACCTTCTGTCAA[G/A]TAAGTCGGTGATTTTGGGCCTTGTGGGCCTACATGAGATAAAATATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021159 Nonsense 391 402 5 5
Genomic Location:
Chromosome 5 (position 57682901)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCACCCTTCACATCCCTGAACTCGCTCAGTGCCAACGGATACAGCAAT[C/T]AACTGTCCTCAGAGATGAAYGAGGGGACCGTCTGGTAGCAAAAAGGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link