ttc27

Ensembl ID:
ENSDARG00000007918
ZFIN ID:
ZDB-GENE-030102-1
Description:
tetratricopeptide repeat protein 27 [Source:RefSeq peptide;Acc:NP_775392]
Human Orthologue:
TTC27
Human Description:
tetratricopeptide repeat domain 27 [Source:HGNC Symbol;Acc:25986]
Mouse Orthologue:
Ttc27
Mouse Description:
tetratricopeptide repeat domain 27 Gene [Source:MGI Symbol;Acc:MGI:1921446]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063772 Nonsense 242 377 6 9

The following transcripts of ENSDARG00000007918 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 22630515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCAGTTCCACCTGGAGTGCAGTTATATCTGCCTGACCTACTATGAGTA[T/A]CACAAGGCCAAAGAACATCTGCAGACGGCTCGTGATCTGTCAGGACTCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0envlhev