xpnpep3

Ensembl ID:
ENSDARG00000007916
ZFIN ID:
ZDB-GENE-040426-2076
Description:
probable Xaa-Pro aminopeptidase 3 [Source:RefSeq peptide;Acc:NP_996962]
Human Orthologue:
XPNPEP3
Human Description:
X-prolyl aminopeptidase (aminopeptidase P) 3, putative [Source:HGNC Symbol;Acc:28052]
Mouse Orthologue:
Xpnpep3
Mouse Description:
X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene [Source:MGI Symbol;Acc:MGI:2445217]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1162 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa1162
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050245 Nonsense 218 510 4 10

The following transcripts of ENSDARG00000007916 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 25180771)
KASP Assay ID:
554-1072.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTAGGAGGAACTGTATGGTATGACAACTCTCAGCCTTGTCATCCACGGT[T/A]ACATCAAACTCATGTGCGCCCCCTGTTGGAAGGAGGACAGCTGGTGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bu709y8z