jak2a

Ensembl ID:
ENSDARG00000007915
ZFIN IDs:
ZDB-GENE-980526-481, ZDB-GENE-980526-481
Description:
Janus kinase 2a [Source:RefSeq peptide;Acc:NP_571168]
Human Orthologue:
JAK2
Human Description:
Janus kinase 2 [Source:HGNC Symbol;Acc:6192]
Mouse Orthologue:
Jak2
Mouse Description:
Janus kinase 2 Gene [Source:MGI Symbol;Acc:MGI:96629]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14232 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004255 Essential Splice Site 1023 1095 23 24
ENSDART00000127639 Essential Splice Site 1023 1095 24 25
Genomic Location:
Chromosome 21 (position 208158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTCTGTACGCTCAGTGATGATCAATTCTCCTGATGCTGTGCTGTGTTC[A/T]GGTGTTCATGGAGCAGATGGGTGAGGATAAACAGGGTCAGATGATCGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: A genome-wide association study identifies 2 susceptibility Loci for Crohn's disease in a Japanese population. (View Study)
  • Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Myeloproliferative neoplasms: A germline JAK2 SNP is associated with predisposition to the development of JAK2(V617F)-positive myeloproliferative neoplasms. (View Study)
  • Ulcerative colitis: A genome-wide association study identifies three new susceptibility loci for ulcerative colitis in the Japanese population. (View Study)
  • Ulcerative colitis: Genome-wide association identifies multiple ulcerative colitis susceptibility loci. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rwvtcour