si:ch211-196i2.2

Ensembl ID:
ENSDARG00000007912
ZFIN ID:
ZDB-GENE-091118-111
Human Orthologue:
COL16A1
Human Description:
collagen, type XVI, alpha 1 [Source:HGNC Symbol;Acc:2193]
Mouse Orthologue:
Col16a1
Mouse Description:
collagen, type XVI, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1095396]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37257 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39323 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051456 Essential Splice Site 5 898 1 40
ENSDART00000147660   None 240 None 12
Genomic Location (Zv9):
Chromosome 21 (position 12475699)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14176873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGGGCGAACAGGGCAGAGGGGTCACACTGGCATGCCTGGACCTCCT[G/T]TAAGTGTCCAAACACAGATCCTGAGAGTATTGTCAGTCTTTTGTTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051456 Essential Splice Site 392 898 20 40
ENSDART00000147660   None 240 None 12
Genomic Location (Zv9):
Chromosome 21 (position 12467683)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14168857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCGGGCCAAGTGGTTCACCTGGTGAGCCAGGAAATCCTGGACCTGAG[G/A]TTTTTGTTCACTCATATAAATGCATATTCTGCAAATGTGCATAAAATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link