ENSDARG00000007906

Ensembl ID:
ENSDARG00000007906
Human Orthologue:
LRP2
Human Description:
low density lipoprotein receptor-related protein 2 [Source:HGNC Symbol;Acc:6694]
Mouse Orthologue:
Lrp2
Mouse Description:
low density lipoprotein receptor-related protein 2 Gene [Source:MGI Symbol;Acc:MGI:95794]

Alleles

There are 19 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9938 Essential Splice Site Available for shipment Available now
sa35239 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41996 Nonsense Mutation detected in F1 DNA During 2016
sa9724 Nonsense Available for shipment Available now
sa41997 Nonsense Mutation detected in F1 DNA During 2016
sa22063 Nonsense Available for shipment Available now
sa14439 Nonsense Available for shipment Available now
sa35240 Nonsense Mutation detected in F1 DNA During 2016
sa2638 Nonsense Available for shipment Available now
sa22064 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38877 Nonsense Mutation detected in F1 DNA During 2016
sa41998 Nonsense Mutation detected in F1 DNA During 2016
sa22065 Nonsense Mutation detected in F1 DNA During 2016
sa18454 Essential Splice Site Available for shipment Available now
sa17806 Essential Splice Site Available for shipment Available now
sa19033 Nonsense Mutation detected in F1 DNA During 2016
sa1015 Splice Site, Nonsense Available for shipment Available now
sa35241 Nonsense Mutation detected in F1 DNA During 2016
sa30666 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Essential Splice Site 117 4409 3 73
Genomic Location:
Chromosome 12 (position 17207378)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGACCATGTGCCAGACTGTGTGGATAACTCTGATGAGAACAACTGCAG[T/A]ARGAACYTTTCTTCCCATTTACTATTCCTCTGTARCAATGTGGATTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Essential Splice Site 154 4409 5 73
Genomic Location:
Chromosome 12 (position 17209889)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTGCTGTCATTTCCTTTCATATATGTTTTTGTCCTTCATCTCTGAAAC[A/T]GCAAGGCATTGTCAGTCACATCAATTTGAATGTGCTAATGGATTCTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 297 4409 8 73
Genomic Location:
Chromosome 12 (position 17215198)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACACCAGTGTTCTGCTTTGAGCTGTGAGTACCGCTGTCATCCCACCCCA[C/T]AGGGAGGAGCATGCTACTGTCCTGATGGCTTCACTGTGGCCAATGATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 978 4409 20 73
Genomic Location:
Chromosome 12 (position 17226140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACACCTGCATCCAGCCGTGTGTGTGGATGTCCCTTTGGCATGAAGCTG[C/T]AGGAGAACCAGAGAGACTGTGTGAAAGATGACTCTGAGCCCCCTCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 1048 4409 21 73
Genomic Location:
Chromosome 12 (position 17227010)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTAATCAGGTGCAACCTGCTCCCCATATGCATTCACTTGTGGTAAC[A/T]AGCACTGCATCCCTGCTAGATGGCGCTGTGATGGGCATGATGACTGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 1615 4409 29 73
Genomic Location:
Chromosome 12 (position 17236294)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTTGAATTTTTCACTCTGTTCTATCTGTACCTGCAGGTGCTTCAA[C/T]AACCCCATGGCATTACCATCTTCGAAGACAACATCTTCTGGAGTGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 2105 4409 37 73
Genomic Location:
Chromosome 12 (position 17239993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTCATCATACCGAGGCATTTACAGAACAAAGACGGATGGCTCACGCTA[T/G]TCTACAGTCATCAGTCAATTGGGCAATGGAAGAATTCAGGGCTTAGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 2112 4409 37 73
Genomic Location:
Chromosome 12 (position 17240013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACAGAACAAAGACGGATGGCTCACGCTATTCTACAGTCATCAGTCAAT[T/A]GGGCAATGGAAGAATTCAGGGCTTAGCGGTAGACTGGATTGCAGGTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 2704 4409 42 73
Genomic Location:
Chromosome 12 (position 17244421)
KASP Assay ID:
554-2810.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGTGTGATGGCTACAGGGACTGCCTTGATGGGTCTGATGAGCTTGAA[C/T]GAGTTTGTGGTAAGTGACTTTAGCAATTTAACAGTTGTTTCATTTAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Essential Splice Site 2707 4409 42 73
Genomic Location:
Chromosome 12 (position 17244432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTACAGGGACTGCCTTGATGGGTCTGATGAGCTTGAACGAGTTTGTGG[T/C]AAGTGACTTTAGCAATTTAACAGTTGTTTCATTTAGTTTGCATATGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 2750 4409 43 73
Genomic Location:
Chromosome 12 (position 17244657)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGACTGTGGAGATAACAGCGACGAGCATGGTTGTCCCTTCCCTACTTG[T/A]AACCCTTCCACAGAATTCACCTGTGCTAACGGACGCTGCATCAGTGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 2796 4409 44 73
Genomic Location:
Chromosome 12 (position 17247377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACATATTTCATCTAATTTATTAGCGGATCGAACCTGTGCACCTGGCT[T/A]AGTGAAATGTGACACCACCAACATCTGCATTCCTTCGAGCAGCCTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 3369 4409 52 73
Genomic Location:
Chromosome 12 (position 17256406)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTAATATTTGTTTTGCTACAGTTATGCTGATATGGATGGTCAAAAC[A/T]GACACAGAGCTATAACAGGCTCCTTGCCCCATGCTTACGCTCTGACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Essential Splice Site 3435 4409 52 73
Genomic Location:
Chromosome 12 (position 17256606)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCGCCCTAATGACATTCATAYCTATCACCCYTACAGACAGCCACACAG[T/A]AAGACAGCATATTATTTAKTTCACYATTAACTTCAATTGTTTGATAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Essential Splice Site 3494 4409 53 73
Genomic Location:
Chromosome 12 (position 17256863)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGGCCGACTGCTCCAGCACTCAGTTCCGCTGTGGAGACAATGAGAA[G/T]TATGTGAATTMATTMTCTCATGATTTCCCAGGGTATTTAATTAATCTWAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 3612 4409 55 73
Genomic Location:
Chromosome 12 (position 17261737)
KASP Assay ID:
2260-5180.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACGGACAGTTGCATAGACAAGACCTGTAAACCTGGACAGTTTCAATG[C/A]AAAAAAGGAGGCTGCATACCACAAAGTTATGTGTGTGATGCACAGAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Splice Site, Nonsense 3684 4409 56 73
Genomic Location:
Chromosome 12 (position 17262033)
KASP Assay ID:
554-0919.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGATGGCACCAATGATTGTCTAGACAACAGTGATGAGAACACCTG[T/A]CGTGAGTCCTATAGAATGATTTCAATTGATTCAAAAAAGGTTGGACAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa35241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Nonsense 3965 4409 63 73
Genomic Location:
Chromosome 12 (position 17267130)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACAAACCTGAATGGCACTGGCTTTATCTGTTCTTGTCGTCCTGGCTA[T/A]GCAGTAGATCCTGATAACACCTTTCTTTGCAACGGTACACACAAATGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079326 Essential Splice Site 4165 4409 67 73
Genomic Location:
Chromosome 12 (position 17269163)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTGACCTGGAAGCACCTAATTCTGTGGCATTGAACCCTCGCTTGGG[G/A]TGAGATTTACTTGCTCTTACTGTCTGTTTAAAGGGAAAGTTCACTCCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link