crnkl1

Ensembl ID:
ENSDARG00000007901
ZFIN ID:
ZDB-GENE-040426-694
Description:
crooked neck-like protein 1 [Source:RefSeq peptide;Acc:NP_957240]
Human Orthologue:
CRNKL1
Human Description:
crooked neck pre-mRNA splicing factor-like 1 (Drosophila) [Source:HGNC Symbol;Acc:15762]
Mouse Orthologues:
AC153386.1, AC156399.1, Crnkl1
Mouse Description:
Crn, crooked neck-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1914127]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43537 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43537
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112689 Essential Splice Site 67 754 2 14
Genomic Location (Zv9):
Chromosome 20 (position 49387595)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49274743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCACCGATAAAGAAGAGCTCAATGACTACAAACTGAAAAAGAGAAAGG[T/A]ATGAAATGTTGTATCACCATGTAGTATACCATGGTGTCACTATATGCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link