csf1ra

Ensembl ID:
ENSDARG00000007889
ZFIN ID:
ZDB-GENE-001205-1
Description:
Macrophage colony-stimulating factor 1 receptor [Source:UniProtKB/Swiss-Prot;Acc:Q9I8N6]
Human Orthologue:
CSF1R
Human Description:
colony stimulating factor 1 receptor [Source:HGNC Symbol;Acc:2433]
Mouse Orthologue:
Csf1r
Mouse Description:
colony stimulating factor 1 receptor Gene [Source:MGI Symbol;Acc:MGI:1339758]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15067 Nonsense Available for shipment Available now
sa9484 Essential Splice Site Available for shipment Available now
sa22726 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15067
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098594 Nonsense 329 960 5 20
Genomic Location:
Chromosome 15 (position 43678363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTGAGCGAAGGAGACGATGTGGATCTCGGGGTTTTGATCGAAGCGTA[T/A]CCTCCTCTGACTTCACAMAAGTGGGAGACRCCCACATCCCATAATGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098594 Essential Splice Site 642 960 12 20
Genomic Location:
Chromosome 15 (position 43686401)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCAGCATAAGAACWTCGTCAACCTGCTSGGTGCCTGCACACATGGAGG[T/C]ASGACACACACTGGATTTTCCTTTCKATTCTGTACCATTTTTGCTTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098594 Nonsense 734 960 15 20
Genomic Location:
Chromosome 15 (position 43693512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTTAACGTTCTCCAGATTCTTCGTCGGAGTGTCAGGAGGACTCGTG[G/A]CCGCTGGACATGGATGATTTACTCAGATTCTCCTCTCAGGTGGCGCAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8u40tzy6