fancl

Ensembl ID:
ENSDARG00000007885
ZFIN ID:
ZDB-GENE-040426-1045
Description:
E3 ubiquitin-protein ligase FANCL [Source:RefSeq peptide;Acc:NP_998147]
Human Orthologue:
FANCL
Human Description:
Fanconi anemia, complementation group L [Source:HGNC Symbol;Acc:20748]
Mouse Orthologue:
Fancl
Mouse Description:
Fanconi anemia, complementation group L Gene [Source:MGI Symbol;Acc:MGI:1914280]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35494 Essential Splice Site Available for shipment Available now
sa35495 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa9453 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020946 Essential Splice Site 121 371 None 14

The following transcripts of ENSDARG00000007885 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 26930451)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 26576111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATTATTCGCAGCTGATAACAGAGATGGAGATCTTGGGATGGGATAAG[T/A]ATGTTCTCCGAGGTTCACGTTGCACAATGTTTCCCTCTAATAACATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020946 Splice Site, Nonsense 154 371 7 14

The following transcripts of ENSDARG00000007885 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 26987312)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 26632972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTATTAAACCATAATTATCTCTCACATTTTTTTCTCTTTGTTCAGTA[T/A]CCAGCTGAGGCTCCAGAGTTTTCTGCGGATCTTCCAATTCCTCTGGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020946 Nonsense 295 371 11 14

The following transcripts of ENSDARG00000007885 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 26999504)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 26645164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATATGAAAGATGTGTTGGAGATTGAATTTCCATCGCCTACCACCCAC[G/T]AAAAATCTGTACGTTGCATATTTTCGTCTCATAGACTGCCACTTACTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link