ehd3

Ensembl ID:
ENSDARG00000007869
ZFIN ID:
ZDB-GENE-041014-352
Description:
EH domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001038469]
Human Orthologue:
EHD3
Human Description:
EH-domain containing 3 [Source:HGNC Symbol;Acc:3244]
Mouse Orthologue:
Ehd3
Mouse Description:
EH-domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1928900]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6644 Nonsense Mutation detected in F1 DNA During 2014
sa6645 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022694 Nonsense 208 535 4 6
Genomic Location:
Chromosome 20 (position 38257178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCACAAGCTGGACATCTCAGATGAGTTTTCAGAGGTCATCAAGGCCCTA[A/T]AGAACCATGAAGACAAGATCCGTGTGGTGCTCAACAAGGCCGACCAGATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022694 Nonsense 448 535 6 6
Genomic Location:
Chromosome 20 (position 38265751)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGCATTGATGAAGTAGAATGGGTTGTGGCACGTGACAAACCCATGTA[T/A]GATGAAATCTTCTACACTCTCTCGCCTGTCAATGGCAAAGTGACTGGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m1cn6uvr