si:ch211-151f2.1

Ensembl ID:
ENSDARG00000007856
ZFIN ID:
ZDB-GENE-091118-38
Human Orthologue:
RTN4RL1
Human Description:
reticulon 4 receptor-like 1 [Source:HGNC Symbol;Acc:21329]
Mouse Orthologue:
Rtn4rl1
Mouse Description:
reticulon 4 receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:2661375]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21781 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015279 Essential Splice Site 152 355 2 2
Genomic Location (Zv9):
Chromosome 10 (position 37159611)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36014914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTGCTTTTTCCACACCTGCTAACTAACAGTGTTTATCTTACACTTTC[A/C]GAGCAACCAGCTGGAGTTTCTCGAGGATGACATGTTCATTGATCTACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link