ctsl1a

Ensembl ID:
ENSDARG00000007836
ZFIN ID:
ZDB-GENE-030131-106
Description:
cathepsin L, 1 a [Source:RefSeq peptide;Acc:NP_997749]
Human Orthologues:
CTSL1, CTSL2
Human Descriptions:
cathepsin L1 [Source:HGNC Symbol;Acc:2537]
cathepsin L2 [Source:HGNC Symbol;Acc:2538]
Mouse Orthologues:
4930486L24Rik, BC051665, Cts3, Cts6, Cts7, Cts8, Ctsj, Ctsl, Ctsll3, Ctsm, Ctsq, Ctsr
Mouse Descriptions:
cathepsin 3 Gene [Source:MGI Symbol;Acc:MGI:2151929]
cathepsin 6 Gene [Source:MGI Symbol;Acc:MGI:1889619]
cathepsin 7 Gene [Source:MGI Symbol;Acc:MGI:1860262]
cathepsin 8 Gene [Source:MGI Symbol;Acc:MGI:1860275]
cathepsin J Gene [Source:MGI Symbol;Acc:MGI:1349426]
cathepsin L Gene [Source:MGI Symbol;Acc:MGI:88564]
cathepsin L-like 3 Gene [Source:MGI Symbol;Acc:MGI:1917452]
cathepsin M Gene [Source:MGI Symbol;Acc:MGI:1927229]
cathepsin Q Gene [Source:MGI Symbol;Acc:MGI:2137385]
cathepsin R Gene [Source:MGI Symbol;Acc:MGI:1861723]
cDNA sequence BC051665 Gene [Source:MGI Symbol;Acc:MGI:2682300]
RIKEN cDNA 4930486L24 gene Gene [Source:MGI Symbol;Acc:MGI:1922258]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6998 Nonsense Mutation detected in F1 DNA During 2016
sa40539 Nonsense Mutation detected in F1 DNA During 2016
sa20514 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012361 Nonsense 24 337 1 7
ENSDART00000122288 Nonsense 24 337 2 8
ENSDART00000136965 Nonsense 24 203 2 5
ENSDART00000141198 Nonsense 24 195 2 5

The following transcripts of ENSDARG00000007836 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46425035)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44206300
KASP Assay ID:
554-4967.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTACCTTGTGCCTCAGCGCTGTGTTCGCTGCTCCTACTTTRGACCAG[C/T]AATTAAATGATCATTGGGATCAGTGGAAGAAATGGCACAGTAAAAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012361 Nonsense 102 337 3 7
ENSDART00000122288 Nonsense 102 337 4 8
ENSDART00000136965 Nonsense 102 203 4 5
ENSDART00000141198 Nonsense 102 195 4 5

The following transcripts of ENSDARG00000007836 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46425444)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44206709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGGAGTTCAGACAGGTGATGAATGGTTTCAAACACAAGAAAGACAGA[C/T]GATTCAGAGGATCCCTGTTCATGGAGCCCAACTTCATTGAGGTCCCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012361 Nonsense 195 337 4 7
ENSDART00000122288 Nonsense 195 337 5 8
ENSDART00000136965 Nonsense 195 203 5 5
ENSDART00000141198 Nonsense 195 195 5 5

The following transcripts of ENSDARG00000007836 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46427280)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44208545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCTGCAACGGAGGTCTCATGGACCAGGCCTTCCAGTACGTCAAGGAC[C/T]AGAATGGTCTCGACTCTGAGGAATCCTACCCCTACCTGGGAACTGTAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link