ctsl1a

Ensembl ID:
ENSDARG00000007836
ZFIN ID:
ZDB-GENE-030131-106
Description:
cathepsin L, 1 a [Source:RefSeq peptide;Acc:NP_997749]
Human Orthologues:
CTSL1, CTSL2
Human Descriptions:
cathepsin L1 [Source:HGNC Symbol;Acc:2537]
cathepsin L2 [Source:HGNC Symbol;Acc:2538]
Mouse Orthologues:
4930486L24Rik, BC051665, Cts3, Cts6, Cts7, Cts8, Ctsj, Ctsl, Ctsll3, Ctsm, Ctsq, Ctsr
Mouse Descriptions:
cathepsin 3 Gene [Source:MGI Symbol;Acc:MGI:2151929]
cathepsin 6 Gene [Source:MGI Symbol;Acc:MGI:1889619]
cathepsin 7 Gene [Source:MGI Symbol;Acc:MGI:1860262]
cathepsin 8 Gene [Source:MGI Symbol;Acc:MGI:1860275]
cathepsin J Gene [Source:MGI Symbol;Acc:MGI:1349426]
cathepsin L Gene [Source:MGI Symbol;Acc:MGI:88564]
cathepsin L-like 3 Gene [Source:MGI Symbol;Acc:MGI:1917452]
cathepsin M Gene [Source:MGI Symbol;Acc:MGI:1927229]
cathepsin Q Gene [Source:MGI Symbol;Acc:MGI:2137385]
cathepsin R Gene [Source:MGI Symbol;Acc:MGI:1861723]
cDNA sequence BC051665 Gene [Source:MGI Symbol;Acc:MGI:2682300]
RIKEN cDNA 4930486L24 gene Gene [Source:MGI Symbol;Acc:MGI:1922258]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6998 Nonsense Mutation detected in F1 DNA During 2014
sa20514 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012361 Nonsense 24 337 1 7
ENSDART00000122288 Nonsense 24 337 2 8
ENSDART00000136965 Nonsense 24 203 2 5
ENSDART00000141198 Nonsense 24 195 2 5

The following transcripts of ENSDARG00000007836 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 46425035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTACCTTGTGCCTCAGCGCTGTGTTCGCTGCTCCTACTTTRGACCAG[C/T]AATTAAATGATCATTGGGATCAGTGGAAGAAATGGCACAGTAAAAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012361 Nonsense 195 337 4 7
ENSDART00000122288 Nonsense 195 337 5 8
ENSDART00000136965 Nonsense 195 203 5 5
ENSDART00000141198 Nonsense 195 195 5 5

The following transcripts of ENSDARG00000007836 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 46427280)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCTGCAACGGAGGTCTCATGGACCAGGCCTTCCAGTACGTCAAGGAC[C/T]AGAATGGTCTCGACTCTGAGGAATCCTACCCCTACCTGGGAACTGTAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ymzyg5l8