map2k1

Ensembl ID:
ENSDARG00000007825
ZFIN ID:
ZDB-GENE-040426-2759
Description:
dual specificity mitogen-activated protein kinase kinase 1 [Source:RefSeq peptide;Acc:NP_998584]
Human Orthologue:
MAP2K1
Human Description:
mitogen-activated protein kinase kinase 1 [Source:HGNC Symbol;Acc:6840]
Mouse Orthologue:
Map2k1
Mouse Description:
mitogen-activated protein kinase kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1346866]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6511 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025107 Nonsense 319 395 8 11
Genomic Location:
Chromosome 18 (position 19230362)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGGTCCAGACAGCAGACCTCCCATGGCTATATTTGAGCTACTTGATTA[T/A]ATTGTCAATGAAGTAAGCTTTCAGTGGCGCTTACAAGATCACTAAACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tfx0fljg