CAMTA1

Ensembl ID:
ENSDARG00000007824
Description:
calmodulin binding transcription activator 1 [Source:HGNC Symbol;Acc:18806]
Human Orthologue:
CAMTA1
Human Description:
calmodulin binding transcription activator 1 [Source:HGNC Symbol;Acc:18806]
Mouse Orthologue:
Camta1
Mouse Description:
calmodulin binding transcription activator 1 Gene [Source:MGI Symbol;Acc:MGI:2140230]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12769 Nonsense Available for shipment Available now
sa16711 Nonsense Available for shipment Available now
sa13525 Nonsense Available for shipment Available now
sa21967 Nonsense Mutation detected in F1 DNA During 2014
sa21968 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24895 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046663 Nonsense 173 1626 4 19
Genomic Location:
Chromosome 11 (position 41353171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATRTKTCAGAAGGAAAGACGGAGCACAGCCACAGCGGYGGAAAGAACGGC[C/T]GAGCAGGAGGAGATGGAGCCGCTGGAGCAGGAGGCAGAGAGAAAAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046663 Nonsense 683 1626 4 19
Genomic Location:
Chromosome 11 (position 41354701)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACCTGTGCAATGACACCGATAATAACACCTCTRATAGTTCCCATCAA[C/T]AGCTCCTGCAGGGAGCCGGGTTGGTACCTKGACTTTTTAGCGCYGTAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046663 Nonsense 693 1626 4 19
Genomic Location:
Chromosome 11 (position 41354731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTRATAGTTCCCATCAAYAGCTCCTGCAGGGAGCCGGGTTGGTACCT[G/T]GACTTTTTAGCGCYGTAGGCGCACATCAAACCCTGACCAGCASTGGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046663 Nonsense 1422 1626 13 19
Genomic Location:
Chromosome 11 (position 41384054)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGCCTCTAACTTCCTCTCCTGGCCTGGGAACGGTCCACGGTGGAGCA[C/T]AGCCAGAACTTGACGGCCCTCTTGGGAAACTTGGCATTCAGTCCCCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046663 Essential Splice Site 1484 1626 14 19
Genomic Location:
Chromosome 11 (position 41384831)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCCTGTCCTCTCCACCCTACCTTATCCCCCTCTTCCCCCGTCCTGCA[G/A]GGTCGGCCACTTCGGGAGCAGCAGGAACTGGCAGCTGCTGTCATTCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046663 Nonsense 1618 1626 19 19
Genomic Location:
Chromosome 11 (position 41398376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTCAAGTTAATTATGTAAAACTCTTGTTTTTGCTCTGTTTTTAGGGC[G/T]AAAGAATTGAAAAAGGCCAAGGAACATGAGAACGCCGCAAAGAGCCCCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Periodontal microbiota: Genome-wide association study of periodontal pathogen colonization. (View Study)
  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0f2ju0ew