cyth3

Ensembl ID:
ENSDARG00000007807
Human Orthologue:
CYTH3
Human Description:
cytohesin 3 [Source:HGNC Symbol;Acc:9504]
Mouse Orthologue:
Cyth3
Mouse Description:
cytohesin 3 Gene [Source:MGI Symbol;Acc:MGI:1335107]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12934 Essential Splice Site Available for shipment Available now
sa24908 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9864 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020628 Essential Splice Site 36 396 2 13
Genomic Location:
Chromosome 12 (position 18589513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTCCAATATTAGAAGGAGGAAAAGGGAGCTACTGGATGACATTGAGG[T/C]AGTTTCCTTTAAAGTCATTAGTGCAAWCTTTAGTCTAATCTTTTAAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020628 Essential Splice Site 272 396 9 13
Genomic Location:
Chromosome 12 (position 18601770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCACACCTTCTTTAATCCAGACCGAGAGGGATGGCTGCTAAAACTAGG[T/C]TGGTCATCTTTCTGTTATTAAGTTCTCTTTTTGGTCATGCTTTTTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020628 Nonsense 295 396 10 13
Genomic Location:
Chromosome 12 (position 18602268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGAGGTGGTTCATTTTGACAGACAACTGTCTGTATTACTTTGAATA[T/A]ACTACAGTAAGTTGAACTGTTYAATATTTCCTGTTTTAGSCAATAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1kn2oxym