gas6

Ensembl ID:
ENSDARG00000007804
ZFIN ID:
ZDB-GENE-030131-7773
Description:
growth arrest-specific protein 6 [Source:RefSeq peptide;Acc:NP_956272]
Human Orthologue:
GAS6
Human Description:
growth arrest-specific 6 [Source:HGNC Symbol;Acc:4168]
Mouse Orthologue:
Gas6
Mouse Description:
growth arrest specific 6 Gene [Source:MGI Symbol;Acc:MGI:95660]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9012 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19391 Nonsense Available for shipment Available now
sa32572 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010092 Essential Splice Site 267 648 8 15
Genomic Location (Zv9):
Chromosome 1 (position 198141)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 328271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACGGTCGTCTGGGAAAGAGACTGAGCTCAGACATGAGGAGCTGTGAGG[T/C]GAACRACACACAATACTAGCAGATTATAGGAAAAAGTCAAASYAAATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010092 Nonsense 368 648 10 15
Genomic Location (Zv9):
Chromosome 1 (position 195558)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 325688
KASP Assay ID:
2259-0014.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCGTGAGTCGAGTGACCAGCAGCGGACCGCAGGTCAACGACGGGCAGT[G/A]GCACAAGGTGAGAGGTCAGAGGTCACGAAAAAATGCTGCTCTTATTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010092 Essential Splice Site 598 648 14 15
Genomic Location (Zv9):
Chromosome 1 (position 190709)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 320839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTGGATCTCACATCCTCATACAGCACCTTCATAGGGGGCATCCCAG[G/A]TAATGTCTCACATTGGTCTGGTATGGTCTCACATCCACCTCGCAATAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link