cst3

Ensembl ID:
ENSDARG00000007795
ZFIN ID:
ZDB-GENE-030131-373
Description:
cystatin C [Source:RefSeq peptide;Acc:NP_001026843]
Human Orthologues:
CST1, CST11, CST2, CST3, CST4, CST5, CST8, CSTL1
Human Descriptions:
cystatin 11 [Source:HGNC Symbol;Acc:15959]
cystatin 8 (cystatin-related epididymal specific) [Source:HGNC Symbol;Acc:2480]
cystatin C [Source:HGNC Symbol;Acc:2475]
cystatin D [Source:HGNC Symbol;Acc:2477]
cystatin S [Source:HGNC Symbol;Acc:2476]
cystatin SA [Source:HGNC Symbol;Acc:2474]
cystatin SN [Source:HGNC Symbol;Acc:2473]
cystatin-like 1 [Source:HGNC Symbol;Acc:15958]
Mouse Orthologues:
Cst10, Cst11, Cst13, Cst3, Cst8, Cstl1
Mouse Descriptions:
cystatin 10 (chondrocytes) Gene [Source:MGI Symbol;Acc:MGI:1930004]
cystatin 11 Gene [Source:MGI Symbol;Acc:MGI:1925490]
cystatin 13 Gene [Source:MGI Symbol;Acc:MGI:1916544]
cystatin 8 (cystatin-related epididymal spermatogenic) Gene [Source:MGI Symbol;Acc:MGI:107161]
cystatin C Gene [Source:MGI Symbol;Acc:MGI:102519]
cystatin-like 1 Gene [Source:MGI Symbol;Acc:MGI:2652834]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22344 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065435 Missense 122 128 3 3
ENSDART00000136820 Essential Splice Site 121 134 None 5

The following transcripts of ENSDARG00000007795 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 33907195)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATGCAAAATAGTGGTCTGGACCAAGCTATGGGAGAACTTTATTAAGG[T/G]CACTGAAAACTCCTGCCTGTAGAGAATGCTCCTGTTGCAGTTTGAAGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7y4j9zl1