dyx1c1

Ensembl ID:
ENSDARG00000007792
ZFIN ID:
ZDB-GENE-040426-1892
Description:
dyslexia susceptibility 1 candidate 1 [Source:RefSeq peptide;Acc:NP_991251]
Human Orthologue:
DYX1C1
Human Description:
dyslexia susceptibility 1 candidate 1 [Source:HGNC Symbol;Acc:21493]
Mouse Orthologue:
Dyx1c1
Mouse Description:
dyslexia susceptibility 1 candidate 1 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1914935]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22393 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018411 Essential Splice Site 294 420 6 9
Genomic Location (Zv9):
Chromosome 13 (position 52292445)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2889750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTGACAGAGGACGAGAGAAACCCAGACTGGCTGAAAGACAAGGGAGA[G/T]TCAGTGTCTTCATGCTGTTTTTCTCTCTTTTGTCTGACTTTTTGCAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link