ppp2r1a

Ensembl ID:
ENSDARG00000007791
ZFIN ID:
ZDB-GENE-040426-2700
Description:
protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform [Source:RefSeq pep
Human Orthologue:
PPP2R1B
Human Description:
protein phosphatase 2, regulatory subunit A, beta [Source:HGNC Symbol;Acc:9303]
Mouse Orthologue:
Ppp2r1b
Mouse Description:
protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform Gene [Source:MGI Sym

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7008 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097389   None 477 None 14
ENSDART00000135344 Essential Splice Site 168 589 4 15
Genomic Location (Zv9):
Chromosome 5 (position 59127395)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57108067
KASP Assay ID:
554-4848.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTCTGCTACCCACGTGTTTCCAGTACCGTCAAGGCTGAGATTCGCCAG[T/C]AAGTTTTTGCACATAAATGTTTTACAGGGAATCATTGACAYACATTATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link